Human Variation : Cold Climates

BRRR It's Cold in Here 

1. The negative impacts on the survival of humans homeostasis in cold climates  is that there is constant danger of developing hypothermia. Because the body automatically maintains stable core temperature of 98 degrees Fahrenheit. Hypothermia begin when the core temperature reaches 94.F, below 85.F due to the body staying in the cold the body's natural temperature system fails and with this continuous decline in boy temperature can result to death. When the temperature reaches below freezing the body can undergo obtaining a condition called Frostbite.

2. The Short Term Adaptation : In a cold environment our body will quickly respond by shivering, which is a bodily function generating heat to the cold areas on our body. The increased muscle activity in shivering produces more body heat

The Facultative Adaptation : In cold environment we depend on our bodies to produce the internal heat we need, in which the response is to narrow the blood vessels near the skin (vasoconstriction) preserving body heat by reducing blood flow, that's why sometimes our hands become slightly numb. [ if the body remains in the state of vasoconstriction can result into Frostbite]. The body converts from vasoconstriction to vasodilation ,increasing the warm blood flood, to the skins surface in back and forth function to reduce risk for both conditions 

The Developmental Adaptation: People who live in cold environments consume large calories of fattening foods to add extra heat to the body, their body are more round and thick, The thick fat is coated on the vital organs of the chest and abdomen parts of the body, even when heat is loss the core boy temperature remains the same.




The Cultural Adaptation: In cold environments people will be inclined to wear clothing, that does not expose the bare skin and keep their bodies warm, when it gets chilly out we think to wear a jacket to preserve out heat. Eskimos, living in the northern region of the earth, wear heavy stocky clothing, at night they sleep in huddles where they lay their bodies next to each to retain the heat, and remain active outdoors when it's warmer out. In our environment, when it gets cold we use heaters and blankets throughout our homes to keep warm, catering to hot chocolate and  
sitting around the fireplace. each culture have their different ways of with the cold

3. The benefits is that we are learning how other cultures deal with their environments an taking note we can apply that same knowledge to ourselves if we were ever to deal with that kind of situation. Nature is unpredictable and is not always accurate even in a nice warm climate the weather can change a bit and become cold so it is wise to at least take these variations into consideration, being cold for too long can cause a person to become sick if your not dressed warm enough and all can cause the body to deal with abrupt change if not taken care of in these situation. So the benefits is very helpful to obtain this information, who knows you might want to go to a climate where a lot of snow is conducted.

4. The two races I will compare are eskimos and blacks, since my subject is on cold, the northern regions are more suitable for people of white skin because they have little shielding pigmentation and the solar radiations there is weak, whereas blacks will suffer in colder regions because it prevents them from producing Vitamin D. Ultaviolet Radiation must penetrate the skin in order for the body to produce Vitamin , and people in northern climates lack Melanin. The environment is pretty much where it is best appropriate for us and that our skin is adapted to the climate of that area. Its not so much about race when you think about it because if the world were to be under one specific climate we probably would all have the same color of skin. But from the wide variety of climate we differ, this is what nature does and as we adapt to these variations it contributes to our survival in that area. In a sense, natural selection is very convenient for us because where ever we are it suits us best by the reaction of our skin, and that is where we belong in order to live.

Language Post

 PART 1

1. Did you feel the experiment was easy?

   It was kind of hard because I couldn't use any kind of language, I pretty much had to emphasis my body language to the smallest detail in order for my partner to understand what I was trying to say. I had to repeat myself a lot because it's not easy trying to have a conversation with someone and you have to use your body to express how you feel. I had to use a lot of facial movements and hand gestures to where my entire body was involved in the conversation.

2. What were the impressions of your partners in this conversation? Did they alter their way of communicating with you because of absence of symbolic language?

  My partners impression was it was difficult to understand what I was saying and at parts it didn't make any kind of sense in communications but when I repeatedly acted out my response. Yes they were guessing what I was saying so they substituted what I was intending to say with their version of what they think I was saying, and if it was close enough I gave an accepting response letting them know if they were close to what I was saying.

3. I would say the culture that has the best technique of communicating complex ideas are the ones who are able to speak, because they are also able to use body language completing the form of language at 100%. Speech is very quick to understand and you do not have to directly face someone when talking to them. A person can talk from across the same room or in another room and at a distance the can yell to get your attention, but the person who is only limited to body language has to be watched, while predicting everything they are trying to say, the conversation is longer and harder.
  The people who are deaf and can not hear themselves speak are limited to using body language which they have to develop using sign language in order to be understood. But in this case a person having difficulty speaking, not so much as deaf, but some with speech impediment (mentally disabled) will be able to communicate because they can hear the person talking to them but they would have to use a lot of body language to be understood, which is kind of exhausting and frustrating if a person does not get it. and lastly, our very own babies who we have a very difficult time communicating with them because they don't recognize language and its hard to understand them, but they understand us but are not fully capable of using speech to their advantage, so they fully use body language to try to get parents to satisfy their needs.

PART 2

1. Were you able to last the full 15 mins of using only speech for communication? What made this experiment difficult for you?

   No I was not able to last as long as I did with the non verbal part of the assignment, the conversation became very meaningless, understandable but eventually we stopped talking for a long time being unable to expression myself fully. My partner kind of used some vocal intonations but it was hard trying to have a conversation in that particular manner. Eventually our answers were becoming shorter and shorter to simple answers, we sounded like robots and in a sense it was a non human.

2. How was your partner in this part of the experiment affected by your communication and limitations? 
  
  there was no empathy in what I said and everything I said was very shallow as if i did not mean anything I was saying. There was no serenity in what I was telling them and it made the conversation pointless to move forward because it was not interesting to hear the monotone within my voice.
 

3.What does the experiment says about our "signs" in our language, i.e., how important is non-speech language techniques in our ability to communicate effectively?

  Because we have use a lot of emphasis in our communication to create and effective impact on how we feel about what we are saying,( i.e. Body language sums up 80% of our communication leaving 20% of language to completely a successful conversation.) our emotions is what causes us to communicate and we use that to express our inner selves well enough for the people to understand either how important or less important the topics effects us.

4. I would say people who have difficulty reading body language are some people who are not allowed to express themselves much, or who are entitled to not being taught to speak, but generally we are a very visual species and body language is not hard to read.
  The benefits is that we can read emotions with body language, it reveals to use how people are feeling the facial expression tells us everything about the way we feel or how we want people to feel, and we fully get those feelings out by either our hand gestures, facial movements, some types of thrust with the body. When a person is telling a joke they have to act out the person they are impersonating or change the voice intonations to a certain pitch to mock a person so that joke is funnier to their audience. 
  Well since our environment has changed with vast technologies its not required to reading body language by chatting over the web, you can communicate effectively without having to use any kind of body language and still the other person your are conversing with will understand you.
 

Piltdown Hoax Blog Post

      The Piltdown Hoax, before its true identity was revealed, took part as one of the most influential historical discoveries science has ever made. Though, deceived into science, the Piltdown Man was suppose to be the "missing link" between the evolutionary connection of humans and apes. Piltdown Man was discovered in a gravel pit by Charles Dawson, known as an amateur archaeologist, by which he spotted what seemed to be a humans skull. Later finding a claimed to be human jawbone, which was suppose to date a million years ago. When presented the Piltdown Man in December 1912, the science community was upraise to the discovery and mislead England into thinking that ancient fossils was in their soils as well.
Scientist has found the human related fossils in other locations within Asia an Africa, but they were only date up to 100,000 years ago. This is what brought the rise of suspicion of what really was is Piltdown Man.
 
      Mistakenly accepting the Piltdown Man was probably because the scientist didn't perform the necessary steps and test before publication. The discovery was so astonishing that they were eager to show it to the world without taking precaution. Of course technology was not so advanced back then but if they were to take the time to actually analyze the fossil they could have detected the fraud early on. Evolution can not be proven without evidence and it seems they skip this theory as well. Scientist can not be naive to the marvel of what was found by presentation with no facts, if its to good to be true most of the time is not what it really is.

       These fault should teach Scientist that research methodology will provide relative datas, analysis and techniques should be taken into consideration so that the world of science will not be mislead. Quoted within Piltdown Man Hoax Video Part 1, stated that "it is embarrassing" because those scientist should have detected the fraud, the fossil does look tamper with because the tooth is too smooth for it to be an ancient human. It take a process to prove something is fact in science because those studies are record and then perform over again by future scientist. but the data was not adding up like any other fossil, how can the new findings of fossil be dated younger than the Piltdown Man but their are similar in jawbone structure. This became a problem and so the research method begins, they tested the jawbone by submerging it into fluorine. The amazing results were that they fossil was stained, to give it a darker color and like I mentioned earlier the teeth were filed smoothly and the creases within the bones were carved with a knife. This fossil belonged to a female orangutan dated 100,000 years ago just like the other fossils, the embarrassment of being mislead by a tampered fossil for 40 years.

     I wouldn't say remove human factors but remove desperation and self-pride as initial motives for finding the next great discovery. Emotions alone can cause conflicts in science creating bias theories which are not feasible for proper research. The personal human factors can cause damage to the continuity of studies, generations could be mislead like this situation with the Piltdown Man, everything demands the fundamentals of scientific research. Frauds like Charles Dawson, could have motives that was so eager to be noticed for finding a simple ape jaw he wanted the world to think he found something pertaining to man. As disgusting as it sounds his motive to present a lie is not honored, but the positive thing is that it make the scientist more aware of these types of frauds, should have been soon than later.

    The life lessons you could learn about this event is that not all that is "said" to be true, is true. Looks can be very deceiving and anybody can tell a white lie with a straight face to gain any type of recognition from it, if their clever. Overall without the necessary supporting facts and details it is not worth risking alternating knowledge for some self-egoism. Methodology is important and the greater rewards comes in truth. Always keep science pure because we never know how close we are to what we want to know about our world.

   

Loco Motor Patterns of Primates

LEMURS (Promisimians)

                                           

a. Lemurs common home is in Madagascar with less competition from other primates, living in tropical rainforest.

b. Lemurs loco motor patterns; having strong hands and fingers make climbing fairly easy, their long bushy tail is used to help the Lemur balance their jumps, by hopping to the next branch. The Lemurs are able to hop 10 m in between branches, their muscular legs just are not built for walking, so they quadrupedal. Some Lemurs can hop while on their back legs from side to side.

c. Lemurs live in the tree top their loco motor patterns help them access through the trees, because traveling on the ground for a Lemur can be a challenge. Its safer for the Lemurs to be in trees away from the environments carnivores.

SPIDER MONEY

a.New world monkeys, generally living in Central or South America, they are mostly found in the rainforest of Brazil

b. Their loco motor patterns are quadrupetal (which consist of them using thier four limbs to walk and run), brachiate using their arms and legs at a high velocity (only having four fingers and no thumb), hang from branches by their powerful tails, making them look like a spider.

c. In a Rainforset Spider Monkeys can hang from trees to grab on to foods, Living in the high canopy of the rain forest and venturing on the rainforest floor, they are highly hunted so the ground is a danger to their survival, by the cutting of trees Spider Monkey are and endangered species.

BABOON

a. Baboon, lives in a variety of places that required rocky cliffs and tall trees, they reside in Southeast Asia, Middle East, and Africa. Baboon can be found living in the grasslands or the mountains some make a living in the rain forest as well.

b.Baboon are terrestrial, ground dwelling, traveling up to five to seven miles per day, they feed while moving , preferring to quadrupedal on their toes and knuckles.

c. Baboon are extremely adaptable to varieties of habitats, as long as theirs water and a safe sleeping, which they choose either tall trees or cliff faces when their predator come they escape on the grounds or form a blockade.  

GIBBON

a. The Gibbon, asian apes, can be found in Southeast Asia, living in the tropical rainforest.

b.Gibbons are extremely acrobatic, their loco motor patterns are brachiating 90% of their travel swinging from branch to vines. they can quadrupetal along branches ( like tightropes) and jump over 30 feet between gaps.

c. Gibbon are tree-dwelling apes, they spend most of their entire lives in the trees. they rarely descend to the ground where almost no predator can catch them.

CHIMPANZEE

a. Chimpanzee live in large variety of habitats, mainly found living on the forest edge or clearing of a tropical rain forest. They also live in woodlands, swamp forest, and grassland in West Africa

b.Chimpanzee's loco motor patterns are usually to quadrupetal on the soles of their feet and knuckles, and are very good climbers. Their long arms helps them to swing from branch to branch, brachiate.

c. Chimpanzee in various environments near or in trees avoiding direct sunlight, their long arms are used to help them locomote to different areas 

SUMMARY

In conclusion to my findings, the physical inherited traits are convenient for these primates to survive in their different habitats, All of these behaviors are essential for their distinct environments, where they are located is what they need to survive in that area, if these primates were to be migrated into a foreign environment their survival can be critical, due to what they lack in comparison to the other primates.

Analogy and Homology

 HOMOLOGY TRAITS

1) . a.  Lions and Tigers are both from the family of Big Cats, being meat eaters, they are classified as Carnivore landing them at the top of the food chain. With no actually predation living in wild habitats because they are the ones doing the hunting. 

 b. The Homologous traits are the  4 limbs and a bony skeleton, the differences are that the Lion is actually smaller than the Tiger. Lions having sharper teeth weighing at an average male of 300-430lbs, whereas the tiger having a wider mouth but stronger teeth weighing at 488-510lb. The Lions Mane is in either color of Black or Tan and the Tiger is strictly stripes, (Interestingly they form hybrids called Ligers)

c. The earliest cats evolved 200 million years ago from Reptiles, the Miacids whiche lived 33-65 Million years ago gave birth to the family of Cats   [Interestingly, The Saber Tooth Tigers  being about the same size as the Lion, but with 2 large canine teeth that extends outside their mouth, was a Prehistoric Machairodontinae (subfamily of Felidae, Family of Cats) which lived 10,000 years ago and became extinct before the Tiger and Lions, they are not descendants of Saber-tooth.]

ANALOGY TRAITS

2). a. Cats living in common areas as Mice which are in predation of the cat, to their habitat in living around them can be dangerous for the mouse but they tend to be mammals right along with cats.

b. Their analogous traits are they are mammals with 4 limbs, flexible and a tail, But Cats coming in a much larger size are carnivores, having some of the same characteristics as the big cats only they hunt smaller prey. Cats have large eye sockets, and sharp teeth used for killing prey and tearing meat. The Cats claws are shielded in there paws to keep them sharp and from dulling on the ground, also allowing them to pounce and climb. The mouse, with a hairless tail, in their paws is hairless as well with claws are extended outward.  A mouse is a herbivore having sharp teeth to nibble at wood, particularly prefer eating seeds from plants and any kind of fruits.

c. Hmm. these two species of Felidae and Mus Musculus have hair and they have 4 limbs containing a tail, the Mus Musculus (mouse) survived after the Era of Dinosaurs because they eat seeds,so their might have been a special event.

My DNA in Need of mRNA

GGCTTTACCTTTAAGGACTCACAACTGAAAACGGCAACACCCCTTTATTCATCTCGTT

Historical Influences: Thomas Malthus

1.) I did research on Thomas Malthus, who I believe has a great influence on Darwin and his studies. Thomas Malthus was an economist, which Darwin was intrigued by his essay "The Principals of Population". Malthus statement of perpetual struggle is that those that were less able to survive and reproduce would eventually die out, ("The population growth would always overpower food supply growth, creating perpetual states of hunger, disease, and struggle.")Thomas Malthus. This statement is similar to one of Darwin's bullet points to the four processes of Natural Selection, which is, the struggle of existence.. In a sense, Malthus believed that disease and hunger were systems placed by God to stop over population,

2.) Malthus share a positive influence, in this case, Darwin was able to build from Malthus idea of perpetual struggle which helps base a hypothesis in his study of evolution. But the theory of evolution is that new species are generated over time through traits passed on in reproduction of the most capable. So can species become extinct?  more like evolved in time until eventually becoming something new species. 

3.) Could Darwin have developed this idea without Malthus's essay? No, because in the context that Malthus introduces the various struggles of nature, and that the less are capable of surviving brought both of them to study the competitive nature in life. But sparked an idea for Darwin to imply that this was "evolution in natural selection".

4.) With this idea, Darwin anticipated that the he could come into a lot of problems with the church, with the example of Galileo. Because he knew his studies went against the church, as blasphemy. The Church strictly believed that everything being on this planet was the design of God and Darwin's Theory was more of species creating new species. His theory on evolution was so influential it could impact a new era in science and a change in society. The Church rejected the book, but later came to accept and publish his book "Origin of Species", but it was banned.