Piltdown Hoax Blog Post

      The Piltdown Hoax, before its true identity was revealed, took part as one of the most influential historical discoveries science has ever made. Though, deceived into science, the Piltdown Man was suppose to be the "missing link" between the evolutionary connection of humans and apes. Piltdown Man was discovered in a gravel pit by Charles Dawson, known as an amateur archaeologist, by which he spotted what seemed to be a humans skull. Later finding a claimed to be human jawbone, which was suppose to date a million years ago. When presented the Piltdown Man in December 1912, the science community was upraise to the discovery and mislead England into thinking that ancient fossils was in their soils as well.
Scientist has found the human related fossils in other locations within Asia an Africa, but they were only date up to 100,000 years ago. This is what brought the rise of suspicion of what really was is Piltdown Man.
 
      Mistakenly accepting the Piltdown Man was probably because the scientist didn't perform the necessary steps and test before publication. The discovery was so astonishing that they were eager to show it to the world without taking precaution. Of course technology was not so advanced back then but if they were to take the time to actually analyze the fossil they could have detected the fraud early on. Evolution can not be proven without evidence and it seems they skip this theory as well. Scientist can not be naive to the marvel of what was found by presentation with no facts, if its to good to be true most of the time is not what it really is.

       These fault should teach Scientist that research methodology will provide relative datas, analysis and techniques should be taken into consideration so that the world of science will not be mislead. Quoted within Piltdown Man Hoax Video Part 1, stated that "it is embarrassing" because those scientist should have detected the fraud, the fossil does look tamper with because the tooth is too smooth for it to be an ancient human. It take a process to prove something is fact in science because those studies are record and then perform over again by future scientist. but the data was not adding up like any other fossil, how can the new findings of fossil be dated younger than the Piltdown Man but their are similar in jawbone structure. This became a problem and so the research method begins, they tested the jawbone by submerging it into fluorine. The amazing results were that they fossil was stained, to give it a darker color and like I mentioned earlier the teeth were filed smoothly and the creases within the bones were carved with a knife. This fossil belonged to a female orangutan dated 100,000 years ago just like the other fossils, the embarrassment of being mislead by a tampered fossil for 40 years.

     I wouldn't say remove human factors but remove desperation and self-pride as initial motives for finding the next great discovery. Emotions alone can cause conflicts in science creating bias theories which are not feasible for proper research. The personal human factors can cause damage to the continuity of studies, generations could be mislead like this situation with the Piltdown Man, everything demands the fundamentals of scientific research. Frauds like Charles Dawson, could have motives that was so eager to be noticed for finding a simple ape jaw he wanted the world to think he found something pertaining to man. As disgusting as it sounds his motive to present a lie is not honored, but the positive thing is that it make the scientist more aware of these types of frauds, should have been soon than later.

    The life lessons you could learn about this event is that not all that is "said" to be true, is true. Looks can be very deceiving and anybody can tell a white lie with a straight face to gain any type of recognition from it, if their clever. Overall without the necessary supporting facts and details it is not worth risking alternating knowledge for some self-egoism. Methodology is important and the greater rewards comes in truth. Always keep science pure because we never know how close we are to what we want to know about our world.

   

Loco Motor Patterns of Primates

LEMURS (Promisimians)

                                           

a. Lemurs common home is in Madagascar with less competition from other primates, living in tropical rainforest.

b. Lemurs loco motor patterns; having strong hands and fingers make climbing fairly easy, their long bushy tail is used to help the Lemur balance their jumps, by hopping to the next branch. The Lemurs are able to hop 10 m in between branches, their muscular legs just are not built for walking, so they quadrupedal. Some Lemurs can hop while on their back legs from side to side.

c. Lemurs live in the tree top their loco motor patterns help them access through the trees, because traveling on the ground for a Lemur can be a challenge. Its safer for the Lemurs to be in trees away from the environments carnivores.

SPIDER MONEY

a.New world monkeys, generally living in Central or South America, they are mostly found in the rainforest of Brazil

b. Their loco motor patterns are quadrupetal (which consist of them using thier four limbs to walk and run), brachiate using their arms and legs at a high velocity (only having four fingers and no thumb), hang from branches by their powerful tails, making them look like a spider.

c. In a Rainforset Spider Monkeys can hang from trees to grab on to foods, Living in the high canopy of the rain forest and venturing on the rainforest floor, they are highly hunted so the ground is a danger to their survival, by the cutting of trees Spider Monkey are and endangered species.

BABOON

a. Baboon, lives in a variety of places that required rocky cliffs and tall trees, they reside in Southeast Asia, Middle East, and Africa. Baboon can be found living in the grasslands or the mountains some make a living in the rain forest as well.

b.Baboon are terrestrial, ground dwelling, traveling up to five to seven miles per day, they feed while moving , preferring to quadrupedal on their toes and knuckles.

c. Baboon are extremely adaptable to varieties of habitats, as long as theirs water and a safe sleeping, which they choose either tall trees or cliff faces when their predator come they escape on the grounds or form a blockade.  

GIBBON

a. The Gibbon, asian apes, can be found in Southeast Asia, living in the tropical rainforest.

b.Gibbons are extremely acrobatic, their loco motor patterns are brachiating 90% of their travel swinging from branch to vines. they can quadrupetal along branches ( like tightropes) and jump over 30 feet between gaps.

c. Gibbon are tree-dwelling apes, they spend most of their entire lives in the trees. they rarely descend to the ground where almost no predator can catch them.

CHIMPANZEE

a. Chimpanzee live in large variety of habitats, mainly found living on the forest edge or clearing of a tropical rain forest. They also live in woodlands, swamp forest, and grassland in West Africa

b.Chimpanzee's loco motor patterns are usually to quadrupetal on the soles of their feet and knuckles, and are very good climbers. Their long arms helps them to swing from branch to branch, brachiate.

c. Chimpanzee in various environments near or in trees avoiding direct sunlight, their long arms are used to help them locomote to different areas 

SUMMARY

In conclusion to my findings, the physical inherited traits are convenient for these primates to survive in their different habitats, All of these behaviors are essential for their distinct environments, where they are located is what they need to survive in that area, if these primates were to be migrated into a foreign environment their survival can be critical, due to what they lack in comparison to the other primates.

Analogy and Homology

 HOMOLOGY TRAITS

1) . a.  Lions and Tigers are both from the family of Big Cats, being meat eaters, they are classified as Carnivore landing them at the top of the food chain. With no actually predation living in wild habitats because they are the ones doing the hunting. 

 b. The Homologous traits are the  4 limbs and a bony skeleton, the differences are that the Lion is actually smaller than the Tiger. Lions having sharper teeth weighing at an average male of 300-430lbs, whereas the tiger having a wider mouth but stronger teeth weighing at 488-510lb. The Lions Mane is in either color of Black or Tan and the Tiger is strictly stripes, (Interestingly they form hybrids called Ligers)

c. The earliest cats evolved 200 million years ago from Reptiles, the Miacids whiche lived 33-65 Million years ago gave birth to the family of Cats   [Interestingly, The Saber Tooth Tigers  being about the same size as the Lion, but with 2 large canine teeth that extends outside their mouth, was a Prehistoric Machairodontinae (subfamily of Felidae, Family of Cats) which lived 10,000 years ago and became extinct before the Tiger and Lions, they are not descendants of Saber-tooth.]

ANALOGY TRAITS

2). a. Cats living in common areas as Mice which are in predation of the cat, to their habitat in living around them can be dangerous for the mouse but they tend to be mammals right along with cats.

b. Their analogous traits are they are mammals with 4 limbs, flexible and a tail, But Cats coming in a much larger size are carnivores, having some of the same characteristics as the big cats only they hunt smaller prey. Cats have large eye sockets, and sharp teeth used for killing prey and tearing meat. The Cats claws are shielded in there paws to keep them sharp and from dulling on the ground, also allowing them to pounce and climb. The mouse, with a hairless tail, in their paws is hairless as well with claws are extended outward.  A mouse is a herbivore having sharp teeth to nibble at wood, particularly prefer eating seeds from plants and any kind of fruits.

c. Hmm. these two species of Felidae and Mus Musculus have hair and they have 4 limbs containing a tail, the Mus Musculus (mouse) survived after the Era of Dinosaurs because they eat seeds,so their might have been a special event.

My DNA in Need of mRNA

GGCTTTACCTTTAAGGACTCACAACTGAAAACGGCAACACCCCTTTATTCATCTCGTT